Genome sequencing and assembly of Mesua Ferrea or Nagakeshara

The first draft genome assembly of the plant Mesua Ferrea also colloquially known as Nagakeshara has been published by Patil et.al., 2020. Using high coverage (~180X ) Illumina sequencing data, the draft genome has been assembled using the latest genome assembly software. Due to its importance in traditional medicine and use as a biofuel, the plant has also acquired important religious significance. Infact, it has been made the state flower of the North-eastern states of Tripura and Mizoram. The de novo assembly generated by Patil et.al., 2020 is 614 Mega-base pair (Mbp) in size and has an N50 of 392 Kilo-base pairs (Kbp). The assembly quality is thought to be comparable to other published Malpighiales genomes. 

Some genome assemblies aspire to have even higher N50 values to be considered of high quality. To achieve these exceedingly high contiguity values these projects tend to rely upon Pacbio sequencing data or Nanopore sequencing data. In addition to this, some projects utilize optical mapping data also. However, these advanced methods of sequencing are expensive and equipment for these methods are hard to find. However, the manuscript published by Patil et.al., 2020 adds an additional dimension to their study by performing a comparative analysis of the demographic histories of several forest plants using the PSMC program. Notably, the parameter settings used to run PSMC are noted and proper optimization is performed. This is in contrast a slew of papers which tend to ignore the parameter settings that are to be used.

A previous version of the manuscript titled "CoalQC - Quality control while inferring demographic histories from genomic data: Application to forest tree genomes" dealing with various technical aspects now continues to languish on the Biorxiv repository. This may be a good testament to the fact that good English writing skills and proper structuring of the manuscript is more important than technical correctness when publishing in higher impact factor journals. Appeals to the contrary are interesting but unlikely to make much of an impact.

 

Gene Loss Association Study (GLAS) in budding yeast gets published in PeerJ

A central goal in evolutionary biology is the identification of changes in the genome that result in  changes at the level of the phenotype. Associating gene loss events with a specific phenotype has seen increasing interest with the availability of high quality genome assemblies for large numbers of species. A detailed discussion of the approach and examples of associations that have been successfully established is provided in Shinde et al. 2019. Graphical summary of the idea of Gene Loss Association Studies or GLAS is provided in below figure.

Figure 1 from Shinde et al. 2019

Two years ago, while screening the budding yeast genomes to identify associations between gene loss and kinetochore phenotypes, it became apparent that four genes from the inner kinetochore were missing in Naumovozyma species. The Kobayashi et al. 2015 paper had studied centromeres in both Naumovozyma species with genome assemblies using ChIP-seq and established the uncoventional point centromeres. Hence, this association between gene loss and transition to evolutionary neo-centromeres (ENC's) seemed an important observation to better understand the processes involved in generating ENC's. While the manuscript was under preparation, an influential study (Kasinathan et al 2018) about defining features of centromeres was published from the Henikoff lab. This study was important as they compared sequence characteristics of Naumovozyma centromeres in addition to several other species. Continuing on the work from Henikoff lab we compared the dyad density of the old and new centromeres in both Naumovozyma species. 

Being a bird coloration enthusiast i studied plumage coloration in crows during my PhD. A prominent discovery in the field of bird morphs around this time was the identification of a large chromosomal inversion in Ruff's that associates with a morph polymorphism (see Kupper et al 2016). One breakpoint of this inversion is known to disrupt the essential CENP-N gene. As a result of this lethality, individuals homozygous for the inversion allele don't exist. The existence of this balanced polymorphism has been the focus of subsequent research. One of the four genes that were found to be lost in Naumovozyma was CHL4, an ortholog of CENP-N. This is an interesting example of a gene which can be essential in certain species while becoming dispensable in a different group of species. 

Given the recent interest in neo-centromere formation and its evolutionary emergence and role in karyotype evolution, the time seems ripe for understanding the sequence of genetic events involved in such transitions. Role of centromere repositioning in reproductive isolation has also received attention. My manuscript describing the GLAS in budding yeast was submitted to PeerJ for Peer review sometime after the nationwide lockdown took hold of India (18th of June). Manuscript was assessed by 3 reviewers, each of whom gave constructive and detailed comments. Quality of the manuscript definitely improved based on the feedback from these anonymous reviewers and the editor. Since, PeerJ provides an option to publish the reviewer comments along with the manuscript, these comments can be seen online. Revision is due in approximately 40 days with some flexibility as no fixed deadline is provided. This is a very useful feature as the time taken to revise a manuscript can vary widely from one manuscript to another. Overall turnaround time for the reviews seemed reasonable and matched with how detailed the reviewer comments were. First set of reviewer comments were received (on 21st July) approximately 1 month after submission. It took me another one month (19th August) to revise the manuscript as other manuscripts had shorter timelines. PeerJ staff checked the manuscript for various issues to ensure it is properly formatted prior to the second round of review. All this was completed by 26th August. The article was finally accepted on 11th September after a second round of review. PeerJ surprisingly does not have an interactive review system and might be for the better. The total time from submission to acceptance was 86 days (~3 months). Proofing of the article was a very smooth experience that involved annotating the pdf proof and uploading it back again. Shortly after the proof was submitted, the article was scheduled for publication on Sep 29th, 2020. This follows in the tradition of PeerJ publishing articles on every Tuesday and Thursday. The publication is now available on the PeerJ website with the title "Loss of inner kinetochore genes is associated with the transition to an unconventional point centromere in budding yeast"

The appalachian conundrum

We are not living through unprecedented times. Yet, like any other generation we sure do feel so. The ongoing covid-19 epidemic, death of George Floyd, earthquakes and locusts might seem to make the times unprecedented. Let us be assured, the human race has seen much worse and survived to become better. The Spanish flu and Slavery are both thankfully in the past. So one can hope that the pandemic and racism will look like distant past at some point. Unfortunately, now it is not that time yet.

Discrimination against Appalachian people is thought to be real enough to have resulted in the enactment of laws in Cincinnati. Just to clarify, the term Appalachian is not applied to native Americans these days, but rather to Ulster-Scot migrants to the US that have settled in the Appalachian region. Vast majority of these people are white and the potentially derogatory term "redneck" is also used to describe this group which remains mired in poverty. This brings me to the Appalachian Conundrum. It is stated as follows:

Imagine a world, far far away if you will. A tiny planet orbiting a giant start much like our earth and sun. Let us call this planet parth. Parth unlike earth is inhabited by many primate like species that look extremely similar, can all communicate in a common language and have the ability to think. The Conundrum is how would these groups on Parth behave?

Will some species conquer the world and subjugate the others? Would there be a war for resources or dominance? Is it possible for only one species to survive through the strife? Can these species co-exist and cooperate to build a better world? How would this co-existence work? Which groups would make up a greater share of the population on parth? Would there be socio-economic disparities between groups?

These are tough questions to answer. May be an episode of start trek will solve this conundrum for us. 

Role of Hypoxia in breast cancer - Alternative Splicing and Methylation

Missing out on a great opportunity can be suffocating. Suffocation or asphyxiation is the deficiency of oxygen supply in the body. Such deprivation of oxygen is known as hypoxia. Hence, it is probably not surprising that looking for opportunities in hypoxia research can result in such outcomes. The recent Nobel Prize in Physiology was awarded to Semenza and colleagues for their pioneering work on hypoxia. No doubt these scientists have avoided suffocation for so long by incorporating some of the defense mechanisms that the body has developed to counteract the lack of oxygen. The role of hypoxia in tumour microenvironment makes it even more pertinent to understand hypoxia and how it is regulated.

One has to realize that while the body as a whole can experience hypoxia, it is the individual cells that respond to this condition. While some cells might die due to the acute lack of oxygen, certain adjoining cells might manage to survive as the oxygen deficiency was not as pronounced. Understanding this cell to cell heterogeneity in dealing with the lack of oxygen would be next step in unraveling the tumor micro environment. However, this needs sophisticated equipment like the 10x Chromium System that can generate single cell RNA-seq libraries from a cell suspension. Only when you have the instrument you can generate pilot data required by the grant agency. Not surprisingly, you need the said grant money to buy the instrument in the first place. This is probably what smart people call a catch 22. 

We decided to overcome this by categorizing entire tumor samples as hypoxic or normoxic as single cell resolution continues to evade our simple minds. In order to classify the tumor into hypoxic or normoxic we needed a signature that could act as a set of features. The molecular signature database is a great source for obtaining such lists of genes involved in a specific molecular function. These signatures have been meticulously assembled by combing through numerous other published datasets. The hypoxia signature on MSigDb is actually based on approximately 80 other lists taken from various studies (including those published by the great Semenza). In order to evaluate the biological meaningfulness of this signature, we used the ShinyGO tool (as it is very Shiny) to visualize the molecular functions that are prominent in this signature set consisting of 200 genes. 

Hypoxia hallmark signature from MSIGDB enrichment for molecular function (200 genes)

While functions involving sugar metabolism are prominent and make sense, they might not be the ideal set of genes to find hypoxic (single cell like) tumor patients. Hence, we decided to make our own new signature. Details of how this was done is described in the manuscript of Pant et. al., 2020. the new custom signature identified by Pant and colleagues is a leaner list that might help achieve the goal of studying hypoxia heterogeneity by looking at inter-individual variation until intra-individual variation becomes accessible. 

Hypoxia custom signature identified by Pant et.al., 2020

Using this super fantastic new signature that is identified by cleverly combining ChIP-seq and micro-array data, we stratified the public TCGA breast cancer data into hypoxia and normoxic patients. By comparing these two groups of tumors, we hoped to understand the differences that might exists between hypoxic and normoxic regions within the tumor. Since, we are specifically interested in Alternative Splicing (due to its ability to increase complexity without any increase in gene number) and its role in hypoxia, we identified differential spliced isoforms between these two groups. Exonic regions that were isoform specific among these isoforms were identified. Only for these exons, the role of DNA methylation was assessed by looking at correlations between the expression level of these exons and the methylation level of proximal DNA measured using arrays. Code required to replicate the results is available on the github repo here: Hypoxia splicing methylation correlation.

Correcting the nucleotide sequence of the tiger genome at the base-pair level

Tiger is the national animal of not just India but also South Korea, Malaysia and Bangladesh. Such importance accorded to this animal is a reflection of its true grandeur. Unfortunately, the historic range of tigers has diminished drastically in this century leading to tigers being classified as an endangered species. Being an endangered large cat, considerable efforts have been directed at conservation of the tiger. Recent conservation efforts have turned to using genomic tools to answer new questions (for example, see: "Conservation priorities for endangered Indian tigers through a genomic lens").

Most studies focusing on conservation using genetic tools have been dealing with magnitude of the diversity, demographic history and its interaction with geographic extent. These approaches have helped develop strategies to control illegal trade and associated poaching. However, the use of expensive genomic tools to aid conservation efforts is still not a mainstream topic. Despite discussions regarding conservation genomics and its utility, concrete examples of genomics making a difference on the ground are still rare and far between.

When the genomes of primates such as human and chimp were sequenced almost two decades ago, the promise of comparative genomics in identifying human specific traits was of great interest. A very compelling example of differences between human and chimp within the exonic region is that of exon2 in PRM1 gene. The alignment of human and chimp genomes for this region is given below:

Human      GGTGCTGCCGCCCCAGGTACAGACCGCGATGTAGAAGACACTAATTGCACAAAATAGCACATC
Chimpanzee GGTGCTGCCGCCGCAGGTCCAGAATGAGACGTAGAAGACACTAATTGCACAGAATAGCACATC 

Originally, this pattern of four amino-acid encoding differences within a single exon was reported by Sabeti et al 2006 (Positive Natural Selection in the Human Lineage).

Human                    CGCCCCAGGTACAGACCGCGATGTAGAAGACACTAATTGC
Bonobo                   CGCCGCAGGTCCAGACTGAGACGTAGAAGACACTAATTGC
Chimpanzee               CGCCGCAGGTCCAGAATGAGACGTAGAAGACACTAATTGC
Gorilla                  CGCCGCAGGAACAGACTGAGACGTAGAAAACACTAATTGC
Orangutan                CGCCGCAGGTACAGACTGAGATGTAGAAGACACTAATTGC
Gibbon                   CGCCCCAGGTACAGGCTGAGACGTAGAAGACACTAATTGC
Sooty mangabey           CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Drill                    CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Olive baboon             CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Gelada                   CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Crab-eating macaque      CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Macaque                  CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Pig-tailed macaque       CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Vervet-AGM               CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Angola colobus           CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Ugandan red Colobus      CGCCGCAGGTACAGGCGGAGGTGTAGAAGATACTAATTGC
Black snub-nosed monkey  CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Golden snub-nosed monkey CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Ma's night monkey        CGCCGCAGGTATAAGCCGCGGTGTAGAAGACACTAATTGC
Marmoset                 CGCCGCAGGTACAAGCTGCCATGTAGAAGATACTAATTGC
Capuchin                 CGCCGCAGGTACAGACTGAGGTGTAGAAGATACTAATTGC
Bolivian squirrel monkey CGCCGCAGGTACAAGCTGAGGTGTAGAAGATACTAATTGC
Tarsier                  CGCCGCTCCTTCCGGCTGAGGTGTAGAAGATACTGA-CGC
Mouse Lemur              CGCCGCAGGTACAGGTGTAGAAGAAGAAGATACTAAATGC
Greater bamboo lemur     CGCCGCAGGTACAGG------TGTAGAAGATACTAAATGC
Coquerel's sifaka        CGCCGCAGGTACAG---GTGTAGAAGAAGATACTAAATGC
Bushbaby                 CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAAACGC

Using a multiple sequence alignment that spans 27 primate species we are able to further delineate the changes that have occurred in the human lineage vs those that have happened in the chimp lineage. The PRM1 gene codes for a protamine protein that acts as a substitute for histones in the chromatin of sperm during the haploid phase of spermatogenesis. Striking patterns of positive selection and associated changes in the sperm morphology have been documented in various species. Identification of such amino-acid altering substitutions between species would contribute to a better understanding of the species and help define the entity that is the focus of conservation.

Given such interesting insights at the molecular level from genome sequencing, genome sequencing of any species has the potential to reveal interesting new information about a species. The genome of the tiger was first reported by Cho et al 2013 (The tiger genome and comparative analysis with lion and snow leopard genomes). Subsequent studies have used the tiger genome for comparative analysis in many high profile papers to identify patterns of protein evolution. 

Mittal et al 2019 (Comparative analysis of corrected tiger genome provides clues to its neuronal evolution) report corrections in the genome assembly sequence of the first tiger genome published by Cho et al 2013 and currently available as PanTig1.0 on ensemble as part of the release 98 (September 2019). In addition to the support from raw read data, the authors rely upon multiple sequence alignment based ancestral states and re-sequencing data from other individuals to ensure that the corrections that they are performing are correct. Having been on biorxiv for almost a year, this corrected tiger genome will hopefully motivate a speedy update of the tiger genome assembly on ensemble. The underlying program used for genome correction is called SeqBug. It is freely available for download on its own github page and is a better version of BCD.

Wombats are herbivores with CDCA and 15-alpha-OH as the major bile salts

The wombat looks like a overgrown rat or even a cat with rat like features. However, it is neither a rodent nor a carnivore. Being a marsupial confined in its geographic distribution to Australia, many of us have probably never seen it. However, it does look similar to the koala bear in someways. Their claws and front teeth are used for burrowing as well as eating tough vegetation. These species feed on roots and bark. A very slow metabolism has been documented and is thought to help them survive in arid environments.

By JJ Harrison (jjharrison89@facebook.com) - Own work, CC BY-SA 3.0, Link

The bile composition of the wombat (Vombatus ursinus) has been quantified using HPLC. It mainly consists of CDCA and 15-alpha OH bile acids. It is unclear whether the other two species of Northern and Southern hairy-nosed wombats (Lasiorhinus krefftii & latifrons) have a similar bile content. Given the frequent changes in bile composition of closely related species, it is possible that bile composition might be different in these other species.

Shinde et al., explores the signatures of relaxed selection in the CYP8B1 gene and finds strong patterns of relaxed selection in the wombat CYP8B1 gene. The time between biorxiving and acceptance of the paper is fairly short given the fast turnaround time of the journal of molecular evolution. All the code used for the analysis along with detailed instructions are posted on the github-CYP8B1 page that goes with the paper. In addition to the striking pattern of relaxation seen in the wombat CYP8B1 gene sequence the manuscript also explores few other aspects related to cetaceans, birds, afrotheria and technical challenges associated with detecting relaxed selection and gene loss. By investigating population level variability of the gene in chicken, we are able to identify the CYP8B1 gene that is not annotated in the latest build of the Gallus gallus genome. Located beside the ACKR2 gene seen in the picture below, it is conserved across a large number of chicken breeds despite having acquired a stop codon in the genome of the individual used for performing genome assembly. Future versions of the chicken genome will hopefully annotate this gene.

Figure 1: Lack of annotation for the CYP8B1 gene in the chicken genome.

Incomplete Bhojeshwar Temple - a treasure trove of insights into ancient temple construction

India is without any doubt a country filled with temples. Every temple that i have been to has a large number of religious visitors and very few "cultural" only visitors. Fortunately, i visited a very interesting temple recently. This temple is incomplete and has been for almost a thousand years and tends to attract many non-religious visitors as it does not have traditional pooja (worship).

It is unclear why the temple construction was abandoned. However, anecdotal stories about why the construction was stopped range from war, natural calamities, superstition and even divine intervention. Nonetheless, the fact that temple construction is frozen in time has made it possible for experts to study temple construction methods of the 11th century. This is similar to freezing natural phenomenon in time to study them. Study of genomes to understand evolutionary processes seems very similar to studying an incomplete temple to understand construction methods.