Wednesday, November 4, 2020

A gene seems to be lost in chicken - is it really true?

Plg-RKT or Plasminogen Receptor K terminal was first identified a decade ago (in the year 2010) based on a proteomics study. Given its recent discovery, the number of research papers focused solely on this protein are limited. List of the papers dealing with the discovery and functional characterization of this protein as well as its relevance to understanding the healthy and disease state of the body are provided in the references. Prior to its characterization, Plg-RKT was known as C9orf46 due to its presence on human chromosome 9 (ORF 46). The original discovery of the role of Plg-RKT and most of the subsequent work related to this protein emanate from the lab of Lindsey Miles (Professor of Cell and Molecular Biology) at The Scripps Research Institute, La Jolla, CA. The 2010 paper notes

“Our isolation of peptides corresponding to C9orf46 homolog is, to our knowledge, the first demonstration of the existence of this protein. We have designated the protein, Plg-RKT, to indicate a plasminogen receptor with a C-terminal lysine and having a transmembrane domain.”

Presence of the C-terminal lysine in this protein seems to be highly conserved across mammals and birds. This lysine residue is exposed on the cell surface and is recognized by plasminogen. The known functions of the Plg-RKT gene can be summarized as follows:

  1. Regulation of macrophage phenotype
  2. Mammary development and lactation
  3. Regulation of efferocytosis
  4. Metabolic homeostasis and adipose function
  5. Mediation of Lipoprotein(a) endocytosis
  6. Regulation of cell surface plasminogen activation

Given the evidence for multiple important functional roles of this gene, it seems unlikely that this gene is dispensable. Several other receptors for plasminogen do exist and could potentially play a compensatory role. The orthologs of Plg-RKT are well conserved and a 1 to 1 ortholog (CG13404 (FBgn0030559)) is annotated in Drosophila melanogaster. A recent pre-print implicates this orthologous gene in Coxiella burnetii Infection susceptibility in Drosophila melanogaster based on a GWAS study that relies on DGRP. Although no ortholog is annotated in yeast, two homologs (tag-280 (WBGene00044322) and tag-281 (WBGene00044323)) are annotated in C. elegans and remain uncharacterised.

To further identify potential gene losses in chicken, we obtained a list of genes that are co-expressed with Plg-RKT in human samples or otherwise known to interact with Plg-RKT and evaluated whether their orthologs are present in chicken. 

 Sl. No Human Gene stable IDGene name Chicken ortholog Remark 
 1 ENSG00000062038CDH3 ENSGALG00000051984 Pseudogene annotation on ensemble but annotated mRNA with ORF at KY120273.1 
 2 ENSG00000137975CLCA2 ENSGALG00000050155 Ortholog found 
 3 ENSG00000149547EI24 ENSGALG00000038097 Ortholog found 
 4 ENSG00000126749EMG1 ENSGALG00000014568 Ortholog found 
 5 ENSG00000068438FTSJ1  Is this lost ??Chicken Chr 12 and Chr 13 breakpoint 
 6 ENSG00000189280 GJB5 ENSGALG00000054289 Ortholog found 
 7 ENSG00000108010GLRX3 ENSGALG00000010464 Ortholog found
 8 ENSG00000196743GM2A ENSGALG00000027534 Ortholog found 
 9 ENSG00000138271GPR87 ENSGALG00000010377 Ortholog found 
 10 ENSG00000113161HMGCR ENSGALG00000014948Ortholog found 
 11 ENSG00000053747LAMA3 ENSGALG00000015056 Ortholog found 
 12 ENSG00000172172MRPL13 ENSGALG00000041863 Ortholog found 
 13 ENSG00000131467PSME3 ENSGALG00000002937 Ortholog found 
 14 ENSG00000087494PTHLH ENSGALG00000017295 Ortholog found 
 15 ENSG00000176225RTTN ENSGALG00000013745 Ortholog found
 16 ENSG00000104549SQLE ENSGALG00000036915 Ortholog found 
 17 ENSG00000056972TRAF3IP2 ENSGALG00000015026 orthology not annotated 
 18 ENSG00000087245MMP2 ENSGALG00000003580 Ortholog found 
 19 ENSG00000100985MMP9 ENSGALG00000006992 Ortholog found 

Most of the above genes have clear 1 to 1 orthologs in chicken. The origin and diversification of the plasminogen activation system has been explored by looking at homologs of 15 genes consisting of the following groups:

  • PLG, HGF and MST-1
  • HABP2, HGFAC, tPA and uPA
  • SERPINE1 (PAI-1), SERPINE2, SERPINE3 and SERPINI1
  • PAI-2
  • VTN
  • 3LU and uPAR
When the orthologs of these genes are searched in chicken, we again find most of them. The exceptions are PLAUR and SERPINE1. Prior work has suggested these genes are lost in chicken. In addition, to these loss events, we see duplication of PLAU and PLG like loci. The potential loss of PLAUR could be interesting as PLAUR is known to interact with PLG. 

Gene stable IDGene nameChicken gene stable ID
ENSG00000173531MST1ENSGALG00000002722
ENSG00000122861PLAU *ENSGALG00000050317
ENSG00000122861PLAU *ENSGALG00000046993
ENSG00000148702HABP2ENSGALG00000008905
ENSG00000163536SERPINI1ENSGALG00000009470
ENSG00000122194PLG *ENSGALG00000028886
ENSG00000122194PLG *ENSGALG00000004293
ENSG00000135919SERPINE2ENSGALG00000005135
ENSG00000011422PLAUR
ENSG00000104368PLATENSGALG00000003709
ENSG00000253309SERPINE3ENSGALG00000017017
ENSG00000109758HGFACENSGALG00000015623
ENSG00000019991HGFENSGALG00000033974
ENSG00000106366SERPINE1
ENSG00000109072VTNENSGALG00000003589

We next compiled the list of all the plasminogen receptors from previous reviews.

Sl NoGene stable IDGene symbolChicken gene stable IDGene nameRemarks
1ENSG00000074800ENO1ENSGALG00000002377alpha-enolaseFirst plasminogen receptor to be identified. See: Activation of plasminogen into plasmin at the surface of endothelial microparticles: a mechanism that modulates angiogenic properties of endothelial progenitor cells in vitro (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2495018/)
2ENSG00000189403HMGB1ENSGALG00000042875Amphoterin 
3ENSG00000197747S100A10ENSGALG00000028774P11 
4ENSG00000107020PLGRKTIs this really lost?Plg-RKT 
5ENSG00000182718ANXA2ENSGALG00000003770Annexin A2 
6ENSG00000170421KRT8 ENSGALG00000050400Cytokeratin 8Orthology not annotated
7ENSG00000005961ITGA2BENSGALG00000054766Integrin Alpha-IIb/beta-3 
8ENSG00000138448ITGAVENSGALG00000002655Integrin AlphaVbeta3 
9ENSG00000169896ITGAMOrthologs found in lizard and alligator but not in birds. Duplication of ITGAX (see: Structural analysis of the CD11b gene and phylogenetic analysis of the alpha-integrin gene family demonstrate remarkable conservation of genomic organization and suggest early diversification during evolution.(https://www.jimmunol.org/content/150/2/480.long))Integrin Subunit Alpha MIntegrin αMβ2 Orchestrates and Accelerates Plasminogen Activation and Fibrinolysis by Neutrophils (https://www.jbc.org/content/279/17/18063.long)
10ENSG00000160255ITGB2ENSGALG00000007511Integrin subunit beta 2 
11Histone genes occur in cluster and all copies retain high levels of sequence similarity. See: Molecular Evolution of the Nontandemly Repeated Genes of the Histone 3 Multigene Family (https://academic.oup.com/mbe/article/19/1/68/1066713)  Histone 2BPhosphatidylserine as an anchor for plasminogen and its plasminogen receptor, Histone H2B, to the macrophage surface (https://onlinelibrary.wiley.com/doi/full/10.1111/j.1538-7836.2010.04132.x)

The Immunogenetics journal has previously (2019 [Convergent inactivation of the skin-specific C-C motif chemokine ligand 27 in mammalian evolution (https://link.springer.com/article/10.1007/s00251-019-01114-z)] and 2018 [Cetacea Are Natural Knockouts for IL20 (https://pubmed.ncbi.nlm.nih.gov/29998404/)]) published gene loss stories in cetaceans. However, both IL20 and CCL27 are well studied genes and the observed loss spanned several species including independent losses. The authors could also provide a fairly convincing explanation for why these genes were lost in cetacean species and provide evidence from re-sequencing datasets and RNA-seq experiments. Loss of NLRC4 and NAIP in pigs was reported [Pig lacks functional NLRC4 and NAIP genes (https://link.springer.com/article/10.1007/s00251-016-0955-5)] in 2017. Being a domesticated species, changes in the immune repertoire of the pig has implications for the pork industry. Interestingly, this paper makes a reference to the lack of RIG-I in chicken and how the immune response is different because of this. 

Given all this background information we wanted to make sure we provided enough evidence for the pseudogenisation of PLGRKT to convince the reviewers. The recently published online PseudoChecker tool failed to find the remnants of the PLGRKT gene. Neither was it able to find the intact gene in Duck when the human exons and CDS were used as the reference. So PLGRKT can be added to the list of less than 5% genes that PseudoChecker is supposedly unable to find. Fortunately, we have been told that real lossomicists (scientists whose specialty is finding gene loss events) use exon by exon tblastx followed by careful scrutiny to prove gene loss. So we did this and find very clear evidence for the existence of exon-3 remains and largely intact exon-4 in chicken. Side by side comparison with results with duck cDNA are provided here: https://github.com/ceglab/PLGRKT/tree/master/tblastx. So all this and the evidence presented by Sharma et. al., suggests this genes is truly lost in chicken. 

In addition to the work done by the Miles lab, recently published papers are from the University of Otago (see talk describing the work here (PLGRKT starts around 30 minutes into the video): https://www.youtube.com/watch?v=0bpNZSZdeQU) and Medical University of Vienna (see video here: https://www.youtube.com/watch?v=xjPmTDkhWr8).

 References

1.      Plasminogen and the Plasminogen Receptor, Plg-RKT, Regulate Macrophage Phenotypic, and Functional Changes (https://www.frontiersin.org/articles/10.3389/fimmu.2019.01458/full)

2.      The Plasminogen Receptor, Plg-RKT, and Macrophage Function (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3484331/)

3.      The Plasminogen Receptor, Plg-RKT, is Essential for Mammary Lobuloalveolar Development and Lactation (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5965281/)

4.      The Novel Plasminogen Receptor, Plasminogen ReceptorKT (Plg-RKT), Regulates Catecholamine Release (https://www.jbc.org/content/286/38/33125.full)

5.      Plasminogen receptors and their role in the pathogenesis of inflammatory, autoimmune and malignant disease (https://onlinelibrary.wiley.com/doi/pdf/10.1111/jth.12064)

6.      Deficiency of Plasminogen Receptor, Plg-RKT, Causes Defects in Plasminogen Binding and Inflammatory Macrophage Recruitment in vivo (https://pubmed.ncbi.nlm.nih.gov/27714956/)

7.      Plasminogen and the Plasminogen receptor, Plg-RKT, regulate efferocytosis and macrophage reprogramming (https://www.fasebj.org/doi/abs/10.1096/fasebj.2018.32.1_supplement.280.4)

8.      The Plasminogen Receptor, Plg-RKT, Regulates Metabolic Homeostasis and Promotes Healthy Adipose Function (https://www.ahajournals.org/doi/abs/10.1161/circ.134.suppl_1.19088)

9.      Proteomics-based discovery of a novel, structurally unique, and developmentally regulated plasminogen receptor, Plg-RKT, a major regulator of cell surface plasminogen activation (https://ashpublications.org/blood/article/115/7/1319/26700/Proteomics-based-discovery-of-a-novel-structurally)

10.  Regulation of Macrophage Migration by a Novel Plasminogen Receptor Plg-R KT (https://pubmed.ncbi.nlm.nih.gov/21940822/)

11.  New Insights Into the Role of Plg-RKT in Macrophage Recruitment (https://pubmed.ncbi.nlm.nih.gov/24529725/)

12.  Plasminogen Receptors: The First Quarter Century (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3938387/)

13.  New Insight on the Role of Plasminogen Receptor in Cancer Progression (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4521684/)

14.  Plasminogen Receptors in Human Malignancies: Effects on Prognosis and Feasibility as Targets for Drug Development (https://pubmed.ncbi.nlm.nih.gov/31755385/)

15.  Differential expression of Plg-RKT and its effects on migration of proinflammatory monocyte and macrophage subsets (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6688429/)

16.  Recycling of Apolipoprotein(a) After PlgRKT-Mediated Endocytosis of Lipoprotein(a) (https://www.ahajournals.org/doi/full/10.1161/circresaha.116.310272)

17.  Natural Genetic Variation in Drosophila melanogaster Reveals Genes Associated with Coxiella burnetii Infection  (https://www.biorxiv.org/content/10.1101/2020.05.21.109371v1.full)

18. Origin and diversification of the plasminogen activation system among chordates (https://bmcevolbiol.biomedcentral.com/articles/10.1186/s12862-019-1353-z)

 


Monday, November 2, 2020

Genome sequencing and assembly of Mesua Ferrea or Nagakeshara

The first draft genome assembly of the plant Mesua Ferrea also colloquially known as Nagakeshara has been published by Patil et.al., 2020. Using high coverage (~180X ) Illumina sequencing data, the draft genome has been assembled using the latest genome assembly software. Due to its importance in traditional medicine and use as a biofuel, the plant has also acquired important religious significance. Infact, it has been made the state flower of the North-eastern states of Tripura and Mizoram. The de novo assembly generated by Patil et.al., 2020 is 614 Mega-base pair (Mbp) in size and has an N50 of 392 Kilo-base pairs (Kbp). The assembly quality is thought to be comparable to other published Malpighiales genomes. 

Some genome assemblies aspire to have even higher N50 values to be considered of high quality. To achieve these exceedingly high contiguity values these projects tend to rely upon Pacbio sequencing data or Nanopore sequencing data. In addition to this, some projects utilize optical mapping data also. However, these advanced methods of sequencing are expensive and equipment for these methods are hard to find. However, the manuscript published by Patil et.al., 2020 adds an additional dimension to their study by performing a comparative analysis of the demographic histories of several forest plants using the PSMC program. Notably, the parameter settings used to run PSMC are noted and proper optimization is performed. This is in contrast a slew of papers which tend to ignore the parameter settings that are to be used.

A previous version of the manuscript titled "CoalQC - Quality control while inferring demographic histories from genomic data: Application to forest tree genomes" dealing with various technical aspects now continues to languish on the Biorxiv repository. This may be a good testament to the fact that good English writing skills and proper structuring of the manuscript is more important than technical correctness when publishing in higher impact factor journals. Appeals to the contrary are interesting but unlikely to make much of an impact.

 



Tuesday, September 29, 2020

Gene Loss Association Study (GLAS) in budding yeast gets published in PeerJ

A central goal in evolutionary biology is the identification of changes in the genome that result in  changes at the level of the phenotype. Associating gene loss events with a specific phenotype has seen increasing interest with the availability of high quality genome assemblies for large numbers of species. A detailed discussion of the approach and examples of associations that have been successfully established is provided in Shinde et al. 2019. Graphical summary of the idea of Gene Loss Association Studies or GLAS is provided in below figure.


Figure 1 from Shinde et al. 2019

Two years ago, while screening the budding yeast genomes to identify associations between gene loss and kinetochore phenotypes, it became apparent that four genes from the inner kinetochore were missing in Naumovozyma species. The Kobayashi et al. 2015 paper had studied centromeres in both Naumovozyma species with genome assemblies using ChIP-seq and established the uncoventional point centromeres. Hence, this association between gene loss and transition to evolutionary neo-centromeres (ENC's) seemed an important observation to better understand the processes involved in generating ENC's. While the manuscript was under preparation, an influential study (Kasinathan et al 2018) about defining features of centromeres was published from the Henikoff lab. This study was important as they compared sequence characteristics of Naumovozyma centromeres in addition to several other species. Continuing on the work from Henikoff lab we compared the dyad density of the old and new centromeres in both Naumovozyma species. 

Being a bird coloration enthusiast i studied plumage coloration in crows during my PhD. A prominent discovery in the field of bird morphs around this time was the identification of a large chromosomal inversion in Ruff's that associates with a morph polymorphism (see Kupper et al 2016). One breakpoint of this inversion is known to disrupt the essential CENP-N gene. As a result of this lethality, individuals homozygous for the inversion allele don't exist. The existence of this balanced polymorphism has been the focus of subsequent research. One of the four genes that were found to be lost in Naumovozyma was CHL4, an ortholog of CENP-N. This is an interesting example of a gene which can be essential in certain species while becoming dispensable in a different group of species. 

Given the recent interest in neo-centromere formation and its evolutionary emergence and role in karyotype evolution, the time seems ripe for understanding the sequence of genetic events involved in such transitions. Role of centromere repositioning in reproductive isolation has also received attention. My manuscript describing the GLAS in budding yeast was submitted to PeerJ for Peer review sometime after the nationwide lockdown took hold of India (18th of June). Manuscript was assessed by 3 reviewers, each of whom gave constructive and detailed comments. Quality of the manuscript definitely improved based on the feedback from these anonymous reviewers and the editor. Since, PeerJ provides an option to publish the reviewer comments along with the manuscript, these comments can be seen online. Revision is due in approximately 40 days with some flexibility as no fixed deadline is provided. This is a very useful feature as the time taken to revise a manuscript can vary widely from one manuscript to another. Overall turnaround time for the reviews seemed reasonable and matched with how detailed the reviewer comments were. First set of reviewer comments were received (on 21st July) approximately 1 month after submission. It took me another one month (19th August) to revise the manuscript as other manuscripts had shorter timelines. PeerJ staff checked the manuscript for various issues to ensure it is properly formatted prior to the second round of review. All this was completed by 26th August. The article was finally accepted on 11th September after a second round of review. PeerJ surprisingly does not have an interactive review system and might be for the better. The total time from submission to acceptance was 86 days (~3 months). Proofing of the article was a very smooth experience that involved annotating the pdf proof and uploading it back again. Shortly after the proof was submitted, the article was scheduled for publication on Sep 29th, 2020. This follows in the tradition of PeerJ publishing articles on every Tuesday and Thursday. The publication is now available on the PeerJ website with the title "Loss of inner kinetochore genes is associated with the transition to an unconventional point centromere in budding yeast"



Friday, June 26, 2020

The appalachian conundrum

We are not living through unprecedented times. Yet, like any other generation we sure do feel so. The ongoing covid-19 epidemic, death of George Floyd, earthquakes and locusts might seem to make the times unprecedented. Let us be assured, the human race has seen much worse and survived to become better. The Spanish flu and Slavery are both thankfully in the past. So one can hope that the pandemic and racism will look like distant past at some point. Unfortunately, now it is not that time yet.

Discrimination against Appalachian people is thought to be real enough to have resulted in the enactment of laws in Cincinnati. Just to clarify, the term Appalachian is not applied to native Americans these days, but rather to Ulster-Scot migrants to the US that have settled in the Appalachian region. Vast majority of these people are white and the potentially derogatory term "redneck" is also used to describe this group which remains mired in poverty. This brings me to the Appalachian Conundrum. It is stated as follows:

Imagine a world, far far away if you will. A tiny planet orbiting a giant start much like our earth and sun. Let us call this planet parth. Parth unlike earth is inhabited by many primate like species that look extremely similar, can all communicate in a common language and have the ability to think. The Conundrum is how would these groups on Parth behave?

Will some species conquer the world and subjugate the others? Would there be a war for resources or dominance? Is it possible for only one species to survive through the strife? Can these species co-exist and cooperate to build a better world? How would this co-existence work? Which groups would make up a greater share of the population on parth? Would there be socio-economic disparities between groups?

These are tough questions to answer. May be an episode of start trek will solve this conundrum for us. 

Friday, February 28, 2020

Role of Hypoxia in breast cancer - Alternative Splicing and Methylation

Missing out on a great opportunity can be suffocating. Suffocation or asphyxiation is the deficiency of oxygen supply in the body. Such deprivation of oxygen is known as hypoxia. Hence, it is probably not surprising that looking for opportunities in hypoxia research can result in such outcomes. The recent Nobel Prize in Physiology was awarded to Semenza and colleagues for their pioneering work on hypoxia. No doubt these scientists have avoided suffocation for so long by incorporating some of the defense mechanisms that the body has developed to counteract the lack of oxygen. The role of hypoxia in tumour microenvironment makes it even more pertinent to understand hypoxia and how it is regulated.

One has to realize that while the body as a whole can experience hypoxia, it is the individual cells that respond to this condition. While some cells might die due to the acute lack of oxygen, certain adjoining cells might manage to survive as the oxygen deficiency was not as pronounced. Understanding this cell to cell heterogeneity in dealing with the lack of oxygen would be next step in unraveling the tumor micro environment. However, this needs sophisticated equipment like the 10x Chromium System that can generate single cell RNA-seq libraries from a cell suspension. Only when you have the instrument you can generate pilot data required by the grant agency. Not surprisingly, you need the said grant money to buy the instrument in the first place. This is probably what smart people call a catch 22. 

We decided to overcome this by categorizing entire tumor samples as hypoxic or normoxic as single cell resolution continues to evade our simple minds. In order to classify the tumor into hypoxic or normoxic we needed a signature that could act as a set of features. The molecular signature database is a great source for obtaining such lists of genes involved in a specific molecular function. These signatures have been meticulously assembled by combing through numerous other published datasets. The hypoxia signature on MSigDb is actually based on approximately 80 other lists taken from various studies (including those published by the great Semenza). In order to evaluate the biological meaningfulness of this signature, we used the ShinyGO tool (as it is very Shiny) to visualize the molecular functions that are prominent in this signature set consisting of 200 genes. 

Hypoxia hallmark signature from MSIGDB enrichment for molecular function (200 genes)
While functions involving sugar metabolism are prominent and make sense, they might not be the ideal set of genes to find hypoxic (single cell like) tumor patients. Hence, we decided to make our own new signature. Details of how this was done is described in the manuscript of Pant et. al., 2020. the new custom signature identified by Pant and colleagues is a leaner list that might help achieve the goal of studying hypoxia heterogeneity by looking at inter-individual variation until intra-individual variation becomes accessible. 

Hypoxia custom signature identified by Pant et.al., 2020
Using this super fantastic new signature that is identified by cleverly combining ChIP-seq and micro-array data, we stratified the public TCGA breast cancer data into hypoxia and normoxic patients. By comparing these two groups of tumors, we hoped to understand the differences that might exists between hypoxic and normoxic regions within the tumor. Since, we are specifically interested in Alternative Splicing (due to its ability to increase complexity without any increase in gene number) and its role in hypoxia, we identified differential spliced isoforms between these two groups. Exonic regions that were isoform specific among these isoforms were identified. Only for these exons, the role of DNA methylation was assessed by looking at correlations between the expression level of these exons and the methylation level of proximal DNA measured using arrays. Code required to replicate the results is available on the github repo here: Hypoxia splicing methylation correlation.

Wednesday, December 11, 2019

Correcting the nucleotide sequence of the tiger genome at the base-pair level

Tiger is the national animal of not just India but also South Korea, Malaysia and Bangladesh. Such importance accorded to this animal is a reflection of its true grandeur. Unfortunately, the historic range of tigers has diminished drastically in this century leading to tigers being classified as an endangered species. Being an endangered large cat, considerable efforts have been directed at conservation of the tiger. Recent conservation efforts have turned to using genomic tools to answer new questions (for example, see: "Conservation priorities for endangered Indian tigers through a genomic lens").

Most studies focusing on conservation using genetic tools have been dealing with magnitude of the diversity, demographic history and its interaction with geographic extent. These approaches have helped develop strategies to control illegal trade and associated poaching. However, the use of expensive genomic tools to aid conservation efforts is still not a mainstream topic. Despite discussions regarding conservation genomics and its utility, concrete examples of genomics making a difference on the ground are still rare and far between.

When the genomes of primates such as human and chimp were sequenced almost two decades ago, the promise of comparative genomics in identifying human specific traits was of great interest. A very compelling example of differences between human and chimp within the exonic region is that of exon2 in PRM1 gene. The alignment of human and chimp genomes for this region is given below:

Human      GGTGCTGCCGCCCCAGGTACAGACCGCGATGTAGAAGACACTAATTGCACAAAATAGCACATC
Chimpanzee GGTGCTGCCGCCGCAGGTCCAGAATGAGACGTAGAAGACACTAATTGCACAGAATAGCACATC 
Originally, this pattern of four amino-acid encoding differences within a single exon was reported by Sabeti et al 2006 (Positive Natural Selection in the Human Lineage).


Human                    CGCCCCAGGTACAGACCGCGATGTAGAAGACACTAATTGC
Bonobo                   CGCCGCAGGTCCAGACTGAGACGTAGAAGACACTAATTGC
Chimpanzee               CGCCGCAGGTCCAGAATGAGACGTAGAAGACACTAATTGC
Gorilla                  CGCCGCAGGAACAGACTGAGACGTAGAAAACACTAATTGC
Orangutan                CGCCGCAGGTACAGACTGAGATGTAGAAGACACTAATTGC
Gibbon                   CGCCCCAGGTACAGGCTGAGACGTAGAAGACACTAATTGC
Sooty mangabey           CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Drill                    CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Olive baboon             CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Gelada                   CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Crab-eating macaque      CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Macaque                  CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Pig-tailed macaque       CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Vervet-AGM               CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Angola colobus           CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Ugandan red Colobus      CGCCGCAGGTACAGGCGGAGGTGTAGAAGATACTAATTGC
Black snub-nosed monkey  CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Golden snub-nosed monkey CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAATTGC
Ma's night monkey        CGCCGCAGGTATAAGCCGCGGTGTAGAAGACACTAATTGC
Marmoset                 CGCCGCAGGTACAAGCTGCCATGTAGAAGATACTAATTGC
Capuchin                 CGCCGCAGGTACAGACTGAGGTGTAGAAGATACTAATTGC
Bolivian squirrel monkey CGCCGCAGGTACAAGCTGAGGTGTAGAAGATACTAATTGC
Tarsier                  CGCCGCTCCTTCCGGCTGAGGTGTAGAAGATACTGA-CGC
Mouse Lemur              CGCCGCAGGTACAGGTGTAGAAGAAGAAGATACTAAATGC
Greater bamboo lemur     CGCCGCAGGTACAGG------TGTAGAAGATACTAAATGC
Coquerel's sifaka        CGCCGCAGGTACAG---GTGTAGAAGAAGATACTAAATGC
Bushbaby                 CGCCGCAGGTACAGGCTGAGGTGTAGAAGATACTAAACGC

Using a multiple sequence alignment that spans 27 primate species we are able to further delineate the changes that have occurred in the human lineage vs those that have happened in the chimp lineage. The PRM1 gene codes for a protamine protein that acts as a substitute for histones in the chromatin of sperm during the haploid phase of spermatogenesis. Striking patterns of positive selection and associated changes in the sperm morphology have been documented in various species. Identification of such amino-acid altering substitutions between species would contribute to a better understanding of the species and help define the entity that is the focus of conservation.

Given such interesting insights at the molecular level from genome sequencing, genome sequencing of any species has the potential to reveal interesting new information about a species. The genome of the tiger was first reported by Cho et al 2013 (The tiger genome and comparative analysis with lion and snow leopard genomes). Subsequent studies have used the tiger genome for comparative analysis in many high profile papers to identify patterns of protein evolution. 

Mittal et al 2019 (Comparative analysis of corrected tiger genome provides clues to its neuronal evolution) report corrections in the genome assembly sequence of the first tiger genome published by Cho et al 2013 and currently available as PanTig1.0 on ensemble as part of the release 98 (September 2019). In addition to the support from raw read data, the authors rely upon multiple sequence alignment based ancestral states and re-sequencing data from other individuals to ensure that the corrections that they are performing are correct. Having been on biorxiv for almost a year, this corrected tiger genome will hopefully motivate a speedy update of the tiger genome assembly on ensemble. The underlying program used for genome correction is called SeqBug. It is freely available for download on its own github page and is a better version of BCD.



Sunday, August 18, 2019

Wombats are herbivores with CDCA and 15-alpha-OH as the major bile salts

The wombat looks like a overgrown rat or even a cat with rat like features. However, it is neither a rodent nor a carnivore. Being a marsupial confined in its geographic distribution to Australia, many of us have probably never seen it. However, it does look similar to the koala bear in someways. Their claws and front teeth are used for burrowing as well as eating tough vegetation. These species feed on roots and bark. A very slow metabolism has been documented and is thought to help them survive in arid environments.
Vombatus ursinus -Maria Island National Park.jpg

The bile composition of the wombat (Vombatus ursinus) has been quantified using HPLC. It mainly consists of CDCA and 15-alpha OH bile acids. It is unclear whether the other two species of Northern and Southern hairy-nosed wombats (Lasiorhinus krefftii & latifrons) have a similar bile content. Given the frequent changes in bile composition of closely related species, it is possible that bile composition might be different in these other species.

Shinde et al., explores the signatures of relaxed selection in the CYP8B1 gene and finds strong patterns of relaxed selection in the wombat CYP8B1 gene. The time between biorxiving and acceptance of the paper is fairly short given the fast turnaround time of the journal of molecular evolution. All the code used for the analysis along with detailed instructions are posted on the github-CYP8B1 page that goes with the paper. In addition to the striking pattern of relaxation seen in the wombat CYP8B1 gene sequence the manuscript also explores few other aspects related to cetaceans, birds, afrotheria and technical challenges associated with detecting relaxed selection and gene loss. By investigating population level variability of the gene in chicken, we are able to identify the CYP8B1 gene that is not annotated in the latest build of the Gallus gallus genome. Located beside the ACKR2 gene seen in the picture below, it is conserved across a large number of chicken breeds despite having acquired a stop codon in the genome of the individual used for performing genome assembly. Future versions of the chicken genome will hopefully annotate this gene.

Figure 1: Lack of annotation for the CYP8B1 gene in the chicken genome.